appendix a:
data formats accepted by MoBIoS
Sequences (dna, rna, and peptide) must be in FASTA format:
| >CHR1v01212004 | one line identifying the sequence, beginning with ">"; |
| CCCTAAACCCTAAACCCTAAACCCTAAACC CTTTAAATCCTACATCCATGAATCCCTAAA CTCTGGTTGAAAATCATTGTGTATATAATG |
followed by one or more lines of sequence. |
One FASTA file may contain any number of sequences.
see mobios-v0.9-examples/dna/data.fasta for an example of a file in FASTA format.
Spectra must be in the following format:
| 3 | one line specifying the number of spectra in the file |
| 0 861.45625 114.0919 201.1239 302.1716 1 224.10220 116.0348 2 231.11560 130.0504 231.0981 |
followed by the given number of spectra, where the first number on each line is the id of the spectra. |
Tandem Spectra must be in the following format:
| 3 | one line specifying the number of spectra in the file |
| 0 861.45625 114.0919 201.1239 302.1716 1 224.10220 116.0348 2 231.11560 130.0504 231.0981 |
followed by the given number of spectra, where the first number on each line is the id of the spectra and the second number is the precursor mass. |
see mobios-v0.9-examples/spectra/ECOLI_GB-tcd_2-zero_mimz.data for an example of a file in this format.
Vector data must be in the following format:
2 7
|
one line specifying the dimension and the number of vectors in the file |
| 0.964623084272023400 0.874672094262884300 0.367999456218279230 0.412298341574510840 0.357376873714089200 0.480545005025524660 0.710523748946818800 0.934324559955898900 0.793549831097389900 0.910451809835068900 0.398115930027975960 0.500990520699254800 0.326475291162297450 0.408129083539293900 |
followed by the given number of vectors with the specified dimension |
see mobios-v0.9-examples/vector/random-5-10000.txt for an example of a file in this format.
